This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00013813


Marker Name:  ATP6V1D 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: ATTGGCAGAACTCCCATGAC
Primer: GCACCCTTTGTTCCTACCTG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AW646743

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: B3 Cat
chromosome B3
971.500 971.500 971.500
Murphy et al 2006: B3 Cat
chromosome B3
1051.000 1051.000 1051.000


© The Roslin Institute 2007-2012, all rights reserved