This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00013798


Marker Name:  MYH6 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: CGTCTTTTCCAACTTCGAGC
Primer: CGTCTTTTCCAACTTCGAGC
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: B3 Cat
chromosome B3
740.900 740.900 740.900
Murphy et al 2006: B3 Cat
chromosome B3
821.900 821.900 821.900


© The Roslin Institute 2007-2012, all rights reserved