This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00013782


Marker Name:  FES 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: GGTGGCCGTGAAATCTTGTA
Primer: CGGAATTATGGGATCGTTCT
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: L77675

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: B3 Cat
chromosome B3
52.700 52.700 52.700
Murphy et al 2006: B3 Cat
chromosome B3
47.100 47.100 47.100


© The Roslin Institute 2007-2012, all rights reserved