This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00013748


Marker Name:  CDKN1A 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: TGCACTCTCATGCCTCACTC
Primer: GGCAGATTAGGGGCTTCCTCT
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: D84650

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: B2 Cat
chromosome B2
466.000 466.000 466.000
Murphy et al 2006: B2 Cat
chromosome B2
454.200 454.200 454.200


© The Roslin Institute 2007-2012, all rights reserved