This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00013745


Marker Name:  RPS18 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: AACAGACAAGGTCTACAGATTTATTTC
Primer: AAAGATTCGGGCCCACAG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AW646808

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: B2 Cat
chromosome B2
373.600 373.600 373.600
Murphy et al 2006: B2 Cat
chromosome B2
393.700 393.700 393.700


© The Roslin Institute 2007-2012, all rights reserved