This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00013742


Marker Name:  FCA838 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: CTCAGGCTTTAAGTGCCCAG
Primer: CTGAGTTTCCTTAGGGCGC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AY434822

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: B2 Cat
chromosome B2
353.100 353.100 353.100
Murphy et al 2006: B2 Cat
chromosome B2
379.000 379.000 379.000


© The Roslin Institute 2007-2012, all rights reserved