This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00013737


Marker Name:  FLAI 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: ACACGCGGATTTACTTGGAC
Primer: TCCACGTCACAGCCATACAT
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: U07670

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: B2 Cat
chromosome B2
304.200 304.200 304.200
Murphy et al 2006: B2 Cat
chromosome B2
320.300 320.300 320.300


© The Roslin Institute 2007-2012, all rights reserved