This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00013730


Marker Name:  EDN1 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: GAGAAGCCGGCTCCCAGT
Primer: GACCCAGATGATGTCCAGGT
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF320770

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: B2 Cat
chromosome B2
103.800 103.800 103.800
Murphy et al 2006: B2 Cat
chromosome B2
94.900 94.900 94.900


© The Roslin Institute 2007-2012, all rights reserved