This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00013727


Marker Name:  FCA834 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: CACGTGCGCATGTAGACAC
Primer: TCCAGGTTGGTCAAATGTGA
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AY434818

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: B2 Cat
chromosome B2
62.300 62.300 62.300
Murphy et al 2006: B2 Cat
chromosome B2
58.200 58.200 58.200


© The Roslin Institute 2007-2012, all rights reserved