This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00013704


Marker Name:  ODF1 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: TCGGGGTCGAAAAAGTACAG
Primer: GTCATGCGTTCCTACGCTTT
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AW646803

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: B1 Cat
chromosome B1
1220.000 1220.000 1220.000
Murphy et al 2006: B1 Cat
chromosome B1
1321.400 1321.400 1321.400


© The Roslin Institute 2007-2012, all rights reserved