This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00013674


Marker Name:  SLC25A4 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: TCTTCAAGTCTGATGGCCTG
Primer: TCTTCAAGTCTGATGGCCTG
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: B1 Cat
chromosome B1
129.800 129.800 129.800
Murphy et al 2006: B1 Cat
chromosome B1
170.100 170.100 170.100


© The Roslin Institute 2007-2012, all rights reserved