This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00013647


Marker Name:  FCA799 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: CACTGGTCTAAAGCAAGCTTCA
Primer: GTGGAAGACCTTTGGTTCCA
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AY434783

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: A3 Cat
chromosome A3
692.800 692.800 692.800
Murphy et al 2006: A3 Cat
chromosome A3
901.900 901.900 901.900


© The Roslin Institute 2007-2012, all rights reserved