This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00013621


Marker Name:  FCA791 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: GGGAACAGAACCAGATGTAAGC
Primer: AGAATGCCCTGCGAAGTG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AY434775

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: A2 Cat
chromosome A2
1477.800 1477.800 1477.800
Murphy et al 2006: A2 Cat
chromosome A2
1921.300 1921.300 1921.300


© The Roslin Institute 2007-2012, all rights reserved