This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00013578


Marker Name:  NFIC 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: TTGCTTGTTTTCCTCCTGTG
Primer: CTGGCCCACGTTTTCAGT
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AW646736

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: A2 Cat
chromosome A2
15.800 15.800 15.800
Murphy et al 2006: A2 Cat
chromosome A2
15.700 15.700 15.700


© The Roslin Institute 2007-2012, all rights reserved