This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00013567


Marker Name:  FCA129 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: ACATAGAGCCGACACGGG
Primer: CGCCTATGTTTACTGCAGCA
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130534

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: A1 Cat
chromosome A1
1931.200 1931.200 1931.200
Murphy et al 2006: A1 Cat
chromosome A1
2327.800 2327.800 2327.800


© The Roslin Institute 2007-2012, all rights reserved