This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00013547


Marker Name:  SMN1 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: agacgcttgactgattgacc
Primer: tctctgccccttccccactta
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF503618

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: A1 Cat
chromosome A1
1364.700 1364.700 1364.700
Murphy et al 2006: A1 Cat
chromosome A1
1701.100 1701.100 1701.100


© The Roslin Institute 2007-2012, all rights reserved