This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00013517


Marker Name:  FCA756 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: AACCAGTTGAGCCATTCAGG
Primer: AACTGGTGCAGCCACTCTG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AY434740

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: A1 Cat
chromosome A1
343.000 343.000 343.000
Murphy et al 2006: A1 Cat
chromosome A1
406.300 406.300 406.300


© The Roslin Institute 2007-2012, all rights reserved