This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00013515


Marker Name:  CHDC1 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: CACGTTTTCTGGTGTTTGTGA
Primer: GGGTGCTCTCTGATTTCAG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: X79682

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: A1 Cat
chromosome A1
226.000 226.000 226.000
Murphy et al 2006: A1 Cat
chromosome A1
247.800 247.800 247.800


© The Roslin Institute 2007-2012, all rights reserved