This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00013053


Marker Name:  FCA145 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: CCTACCTGCTGACTCTGTTGC
Primer: AACTTTTGAGGAAGACCTGGG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130543

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): Xb Cat
chromosome X
4.000 4.000 4.000
Menotti-Raymond, M et al 2003: X Cat
chromosome X
693.700 693.700 693.700
Menotti-Raymond, Marilyn et al 1999 (A): Xa Cat
chromosome X
17.000 17.000 17.000
Murphy et al 2006: X Cat
chromosome X
867.400 867.400 867.400


© The Roslin Institute 2007-2012, all rights reserved