This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00013051


Marker Name:  FCA240 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: TCTTTAAGATGGCCGGACTG
Primer: TCCCCTCAAATATGCAAAGG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130580

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): Xa Cat
chromosome X
6.000 6.000 6.000
Menotti-Raymond, M et al 2003: X Cat
chromosome X
130.800 130.800 130.800
Menotti-Raymond, Marilyn et al 1999 (A): Xb Cat
chromosome X
6.000 6.000 6.000
Murphy et al 2006: X Cat
chromosome X
25.500 25.500 25.500


© The Roslin Institute 2007-2012, all rights reserved