This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00013048


Marker Name:  MYC 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: TACCCTCTCAACGACAGCAG
Primer: GGGCTGTGAGGAGGTTTG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: M15078

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): F2 Cat
chromosome F2
121.000 121.000 121.000
Menotti-Raymond, M et al 2003: F2 Cat
chromosome F2
609.300 609.300 609.300
Murphy et al 2006: F2 Cat
chromosome F2
657.400 657.400 657.400


© The Roslin Institute 2007-2012, all rights reserved