This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00013047


Marker Name:  FCA094 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: TCAAGCCCCATTTTACCTTC
Primer: CACCTGAGCCAAAGGCTATC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130518

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): F2 Cat
chromosome F2
105.000 105.000 105.000
Menotti-Raymond, M et al 2003: F2 Cat
chromosome F2
513.400 513.400 513.400
Menotti-Raymond, Marilyn et al 1999 (A): F2a Cat
chromosome F2
103.000 103.000 103.000
Murphy et al 2006: F2 Cat
chromosome F2
581.100 581.100 581.100


© The Roslin Institute 2007-2012, all rights reserved