This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00013044


Marker Name:  FCA170 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: CAAGGCGTTTGGTATTTTGG
Primer: TTTACAGTCTCCCTCCTGATGC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130552

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): F2 Cat
chromosome F2
71.000 71.000 71.000
Menotti-Raymond, M et al 2003: F2 Cat
chromosome F2
363.800 363.800 363.800
Menotti-Raymond, Marilyn et al 1999 (A): F2a Cat
chromosome F2
70.000 70.000 70.000
Murphy et al 2006: F2 Cat
chromosome F2
383.300 383.300 383.300


© The Roslin Institute 2007-2012, all rights reserved