This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00013043


Marker Name:  FCA350 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: TCAAAATCTTTTTGATGGTTGA
Primer: CTATGAAAGAGCCCAAGTGTCC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130617

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): F2 Cat
chromosome F2
52.000 52.000 52.000
Menotti-Raymond, M et al 2003: F2 Cat
chromosome F2
317.300 317.300 317.300
Menotti-Raymond, Marilyn et al 1999 (A): F2a Cat
chromosome F2
51.000 51.000 51.000
Murphy et al 2006: F2 Cat
chromosome F2
341.000 341.000 341.000


© The Roslin Institute 2007-2012, all rights reserved