This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00013035


Marker Name:  FCA120 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: CCTCCTGTCCTTTTCCATCA
Primer: CTCCTCACTGAATTTTTGAGCA
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130529

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): F1b Cat
chromosome F1
31.000 31.000 31.000
Menotti-Raymond, M et al 2003: F1 Cat
chromosome F1
529.200 529.200 529.200
Menotti-Raymond, Marilyn et al 1999 (A): C1b Cat
chromosome C1
15.000 15.000 15.000
Murphy et al 2006: F1 Cat
chromosome F1
770.700 770.700 770.700


© The Roslin Institute 2007-2012, all rights reserved