This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00013032


Marker Name:  FCA223 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: CTGGGCACTAGGTGTGCAC
Primer: GGTCTTGGATTAGAACCGAGG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130573

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): F1a Cat
chromosome F1
22.000 22.000 22.000
Menotti-Raymond, M et al 2003: F1 Cat
chromosome F1
393.600 393.600 393.600
Menotti-Raymond, Marilyn et al 1999 (A): B3c Cat
chromosome B3
0.000 0.000 0.000
Murphy et al 2006: F1 Cat
chromosome F1
488.000 488.000 488.000


© The Roslin Institute 2007-2012, all rights reserved