This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00013028


Marker Name:  ZNF263 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: CACACTGAAAGAGATGCAACG
Primer: TTGCTGTGCAAAATGAGGTC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AW646943

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): E3b Cat
chromosome E3
54.000 54.000 54.000
Menotti-Raymond, M et al 2003: E3 Cat
chromosome E3
662.900 662.900 662.900
Murphy et al 2006: E3 Cat
chromosome E3
697.200 697.200 697.200


© The Roslin Institute 2007-2012, all rights reserved