This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00013024


Marker Name:  FCA031 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: GCCAGGGACCTTTAGTTAGATT
Primer: GCCCTTGGAACTATTAAAACCA
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130484

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): E3b Cat
chromosome E3
24.000 24.000 24.000
Menotti-Raymond, M et al 2003: E3 Cat
chromosome E3
430.300 430.300 430.300
Menotti-Raymond, Marilyn et al 1999 (A): E3b Cat
chromosome E3
0.000 0.000 0.000
Murphy et al 2006: E3 Cat
chromosome E3
393.000 393.000 393.000


© The Roslin Institute 2007-2012, all rights reserved