This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00013023


Marker Name:  GUSB 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: TGCTGACAAGAGCAGATAGCA
Primer: GCACCTCTGACATTCCCTTC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF012423

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): E3b Cat
chromosome E3
0.000 0.000 0.000
Menotti-Raymond, M et al 2003: E3 Cat
chromosome E3
321.700 321.700 321.700
Murphy et al 2006: E3 Cat
chromosome E3
284.600 284.600 284.600


© The Roslin Institute 2007-2012, all rights reserved