This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00013022


Marker Name:  FCA628 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: CCCCTGCTCATTCTCTCTCA
Primer: GTGCCTGGCACAGCATAAG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130678

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): E3a Cat
chromosome E3
11.000 11.000 11.000
Menotti-Raymond, M et al 2003: E3 Cat
chromosome E3
140.800 140.800 140.800
Menotti-Raymond, Marilyn et al 1999 (A): D2c Cat
chromosome D2
7.000 7.000 7.000
Murphy et al 2006: E3 Cat
chromosome E3
122.500 122.500 122.500


© The Roslin Institute 2007-2012, all rights reserved