This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00013021


Marker Name:  FCA466 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: TGCAAATGGCAGGGTTTC
Primer: GATCAAGAAAATGTACACACG
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): E3a Cat
chromosome E3
0.000 0.000 0.000
Menotti-Raymond, Marilyn et al 1999 (A): D2c Cat
chromosome D2
0.000 0.000 0.000


© The Roslin Institute 2007-2012, all rights reserved