This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00013019


Marker Name:  FCA586 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: CATGACAAATGCTGAGAATGG
Primer: TGTATCTGGAAAGACAGAGCCT
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): E2c Cat
chromosome E2
29.000 29.000 29.000
Menotti-Raymond, M et al 2003: E2 Cat
chromosome E2
698.300 698.300 698.300
Menotti-Raymond, Marilyn et al 1999 (A): A2c Cat
chromosome A2
29.000 29.000 29.000


© The Roslin Institute 2007-2012, all rights reserved