This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00013018


Marker Name:  FCA085 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: CTGTACATTTCTCTTCCCATTGC
Primer: CCCCTACTGGGTGCACTG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130513

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): E2c Cat
chromosome E2
12.000 12.000 12.000
Menotti-Raymond, M et al 2003: E2 Cat
chromosome E2
615.100 615.100 615.100
Menotti-Raymond, Marilyn et al 1999 (A): A2c Cat
chromosome A2
12.000 12.000 12.000
Murphy et al 2006: E2 Cat
chromosome E2
558.900 558.900 558.900


© The Roslin Institute 2007-2012, all rights reserved