This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00013017


Marker Name:  FCA075 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: ATGCTAATCAGTGGCATTTGG
Primer: GAACAAAAATTCCAGACGTGC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130504

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): E2c Cat
chromosome E2
9.000 9.000 9.000
Menotti-Raymond, M et al 2003: E2 Cat
chromosome E2
583.600 583.600 583.600
Menotti-Raymond, Marilyn et al 1999 (A): A2c Cat
chromosome A2
9.000 9.000 9.000
Murphy et al 2006: E2 Cat
chromosome E2
537.300 537.300 537.300


© The Roslin Institute 2007-2012, all rights reserved