This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00013014


Marker Name:  FCA665 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: AACCTGCCTGAGCCAGTG
Primer: TCGGAGAAAATTTCCAGGGGCT
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): E2b Cat
chromosome E2
50.000 50.000 50.000
Menotti-Raymond, M et al 2003: E2 Cat
chromosome E2
459.300 459.300 459.300
Menotti-Raymond, Marilyn et al 1999 (A): A2b Cat
chromosome A2
34.000 34.000 34.000
Murphy et al 2006: E2 Cat
chromosome E2
358.800 358.800 358.800


© The Roslin Institute 2007-2012, all rights reserved