This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00013013


Marker Name:  PHKB 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: GGTTAACAGTCCATACTTCTGAAAAA
Primer: GTGCTGACTTTAGGGGTTGG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AW646749

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): E2b Cat
chromosome E2
37.000 37.000 37.000
Menotti-Raymond, M et al 2003: E2 Cat
chromosome E2
431.500 431.500 431.500
Murphy et al 2006: E2 Cat
chromosome E2
321.500 321.500 321.500


© The Roslin Institute 2007-2012, all rights reserved