This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00013010


Marker Name:  FCA309 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: AGAGATGGGCTCAGTTGCAT
Primer: CTGGTTACCCCGAATTCTCA
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130603

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): E2b Cat
chromosome E2
13.000 13.000 13.000
Menotti-Raymond, M et al 2003: E2 Cat
chromosome E2
300.400 300.400 300.400
Menotti-Raymond, Marilyn et al 1999 (A): A2b Cat
chromosome A2
0.000 0.000 0.000
Murphy et al 2006: E2 Cat
chromosome E2
161.200 161.200 161.200


© The Roslin Institute 2007-2012, all rights reserved