This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00013004


Marker Name:  FCA589 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: TGGGACCCCCAAAACTAAG
Primer: AATCATTACGGATATGGAAACA
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130668

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): E2a Cat
chromosome E2
0.000 0.000 0.000
Menotti-Raymond, M et al 2003: E2 Cat
chromosome E2
62.500 62.500 62.500
Menotti-Raymond, Marilyn et al 1999 (A): C1c Cat
chromosome C1
10.000 10.000 10.000
Murphy et al 2006: E2 Cat
chromosome E2
39.500 39.500 39.500


© The Roslin Institute 2007-2012, all rights reserved