This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00013003


Marker Name:  FCA312 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: GAAGCACCATCAGCCCAC
Primer: TTGGCATTTGGAGTGTATATGC
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): E1b Cat
chromosome E1
31.000 31.000 31.000
Menotti-Raymond, M et al 2003: E1 Cat
chromosome E1
752.000 752.000 752.000
Menotti-Raymond, Marilyn et al 1999 (A): E1b Cat
chromosome E1
14.000 14.000 14.000
Murphy et al 2006: E1 Cat
chromosome E1
1115.900 1115.900 1115.900


© The Roslin Institute 2007-2012, all rights reserved