This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00013002


Marker Name:  MYL4 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: AAGGAGCAGGGCACCTATG
Primer: AGACAGGGCCTGAATCAGGA
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): E1b Cat
chromosome E1
23.000 23.000 23.000
Menotti-Raymond, M et al 2003: E1 Cat
chromosome E1
593.500 593.500 593.500


© The Roslin Institute 2007-2012, all rights reserved