This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00013001


Marker Name:  Fc.182584 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: AAGACATTCCCTCCCACCTC
Primer: GGATGGTTGGAGTCAGAGGA
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AW646917

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): E1b Cat
chromosome E1
19.000 19.000 19.000
Menotti-Raymond, M et al 2003: E1 Cat
chromosome E1
634.200 634.200 634.200
Murphy et al 2006: E1 Cat
chromosome E1
1072.100 1072.100 1072.100


© The Roslin Institute 2007-2012, all rights reserved