This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012995


Marker Name:  FCA005 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: CCTAAGGAAACAGTAATCCTGGC
Primer: TGGCAGGCATACCAGGAT
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130474

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): E1a Cat
chromosome E1
31.000 31.000 31.000
Menotti-Raymond, M et al 2003: E1 Cat
chromosome E1
184.200 184.200 184.200
Menotti-Raymond, Marilyn et al 1999 (A): E1a Cat
chromosome E1
13.000 13.000 13.000
Murphy et al 2006: E1 Cat
chromosome E1
613.800 613.800 613.800


© The Roslin Institute 2007-2012, all rights reserved