This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012994


Marker Name:  NF1 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: TTGGCACGTAAGACAAGCAA
Primer: TTTGTCAGAACTTCCCATAAATGT
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: U82189

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): E1a Cat
chromosome E1
25.000 25.000 25.000
Menotti-Raymond, M et al 2003: E1 Cat
chromosome E1
121.000 121.000 121.000
Murphy et al 2006: E1 Cat
chromosome E1
553.000 553.000 553.000


© The Roslin Institute 2007-2012, all rights reserved