This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012993


Marker Name:  F124 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: TGCTGGGTATGAAGCCTACT
Primer: ATTGCCTCAACTACCTAGGC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130531

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): E1a Cat
chromosome E1
11.000 11.000 11.000
Menotti-Raymond, M et al 2003: E1 Cat
chromosome E1
77.800 77.800 77.800
Menotti-Raymond, Marilyn et al 1999 (A): E1a Cat
chromosome E1
29.000 29.000 29.000
Murphy et al 2006: E1 Cat
chromosome E1
466.600 466.600 466.600


© The Roslin Institute 2007-2012, all rights reserved