This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012990


Marker Name:  FCA045 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: TGAAGAAAAGAATCAGGCTGTG
Primer: GTATGAGCATCTCTGTGTTCGTG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130489

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): D4a Cat
chromosome D4
100.000 100.000 100.000
Menotti-Raymond, M et al 2003: D4 Cat
chromosome D4
806.500 806.500 806.500
Menotti-Raymond, Marilyn et al 1999 (A): A1a Cat
chromosome A1
95.000 95.000 95.000
Murphy et al 2006: D4 Cat
chromosome D4
961.400 961.400 961.400


© The Roslin Institute 2007-2012, all rights reserved