This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012989


Marker Name:  FCA650 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: GCACATTGTGACAATACACACG
Primer: AGGTTTCTAGAAGGTTCCCAGG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130683

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): D4a Cat
chromosome D4
89.000 89.000 89.000
Menotti-Raymond, M et al 2003: D4 Cat
chromosome D4
895.100 895.100 895.100
Menotti-Raymond, Marilyn et al 1999 (A): A1a Cat
chromosome A1
85.000 85.000 85.000
Murphy et al 2006: D4 Cat
chromosome D4
887.800 887.800 887.800


© The Roslin Institute 2007-2012, all rights reserved