This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012987


Marker Name:  FCA242 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: CTCCCCAGGACATTGTGTCT
Primer: ATAGCCAGGCACAGGCTG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130581

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): D4a Cat
chromosome D4
63.000 63.000 63.000
Menotti-Raymond, M et al 2003: D4 Cat
chromosome D4
271.100 271.100 271.100
Menotti-Raymond, Marilyn et al 1999 (A): A1a Cat
chromosome A1
60.000 60.000 60.000
Murphy et al 2006: D4 Cat
chromosome D4
664.700 664.700 664.700


© The Roslin Institute 2007-2012, all rights reserved