This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012986


Marker Name:  CNTFR 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: CCATCCCCTGTTCTCTCAGT
Primer: TCACAGATGACCCCTTCCAC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AZ081276

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): D4a Cat
chromosome D4
62.000 62.000 62.000
Menotti-Raymond, M et al 2003: D4 Cat
chromosome D4
227.500 227.500 227.500
Murphy et al 2006: D4 Cat
chromosome D4
703.400 703.400 703.400


© The Roslin Institute 2007-2012, all rights reserved