This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012985


Marker Name:  FCA030 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: CTGTTGGAACTGGGAGTAAAGG
Primer: ACACATTTTCTCTGCCCCC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130483

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): D4a Cat
chromosome D4
62.000 62.000 62.000
Menotti-Raymond, M et al 2003: D4 Cat
chromosome D4
382.600 382.600 382.600
Menotti-Raymond, Marilyn et al 1999 (A): A1a Cat
chromosome A1
58.000 58.000 58.000
Murphy et al 2006: D4 Cat
chromosome D4
557.600 557.600 557.600


© The Roslin Institute 2007-2012, all rights reserved