This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012983


Marker Name:  FCA618 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: GTCGTTCTCTTTCGTTAGTGGG
Primer: AAAAATTCCAGATTGTGGAACA
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): D4a Cat
chromosome D4
54.000 54.000 54.000
Menotti-Raymond, M et al 2003: D4 Cat
chromosome D4
404.400 404.400 404.400
Menotti-Raymond, Marilyn et al 1999 (A): A1a Cat
chromosome A1
52.000 52.000 52.000
Murphy et al 2006: D4 Cat
chromosome D4
535.300 535.300 535.300


© The Roslin Institute 2007-2012, all rights reserved